anp32b

Ensembl ID:
ENSDARG00000023330
ZFIN ID:
ZDB-GENE-030131-719
Description:
acidic (leucine-rich) nuclear phosphoprotein 32 family, member B [Source:RefSeq peptide;Acc:NP_9977
Human Orthologues:
AC068870.1, ANP32B
Human Description:
acidic (leucine-rich) nuclear phosphoprotein 32 family, member B [Source:HGNC Symbol;Acc:16677]
Mouse Orthologues:
AL592462.1, Anp32b
Mouse Description:
acidic (leucine-rich) nuclear phosphoprotein 32 family, member B Gene [Source:MGI Symbol;Acc:MGI:191

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16651 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16651
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102500 Essential Splice Site 172 259 4 7
Genomic Location:
Chromosome 1 (position 25627471)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGACTCTGATGGAGAGGTCGATGGAGTGGACGACGATGATGACGAGGG[T/C]CAGTGTGAGGGATAGGTTCAGTTTACCAACAGTTTTTTAGGTTGCAGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5e97ph3e