FMN2 (2 of 2)

Ensembl ID:
ENSDARG00000023318
Description:
formin 2 [Source:HGNC Symbol;Acc:14074]
Human Orthologue:
FMN2
Human Description:
formin 2 [Source:HGNC Symbol;Acc:14074]
Mouse Orthologue:
Fmn2
Mouse Description:
formin 2 Gene [Source:MGI Symbol;Acc:MGI:1859252]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7827 Essential Splice Site Mutation detected in F1 DNA During 2016
sa42903 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa7827
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037716 Essential Splice Site 125 247 5 7
Genomic Location:
Chromosome 17 (position 19606893)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGTGTAGAAAACATCTYACTCCTGAGATCTCCATCTTCYTGTTTTAC[A/T]GGMTCTACAATCAGGCCAAGCTGTCCTGCAGATCCTAGGTTTGGYTCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42903
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037716 Essential Splice Site 194 247 7 7
Genomic Location:
Chromosome 17 (position 19603465)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTATTTCCTGTATGATTGCGGTTCAGACTTTCCACTGTTTGTGTGTC[A/G]GGATGCAGGTAAAGAAACGTGCACGTATCCACTTCCAGAACCTCAGGATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link