GPBAR1 (1 of 2)

Ensembl ID:
ENSDARG00000023302
Description:
G protein-coupled bile acid receptor 1 [Source:HGNC Symbol;Acc:19680]
Human Orthologue:
GPBAR1
Human Description:
G protein-coupled bile acid receptor 1 [Source:HGNC Symbol;Acc:19680]
Mouse Orthologue:
Gpbar1
Mouse Description:
G protein-coupled bile acid receptor 1 Gene [Source:MGI Symbol;Acc:MGI:2653863]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34760 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34760
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060590 Nonsense 78 297 1 3
Genomic Location (Zv9):
Chromosome 9 (position 48921670)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 48269949
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCAGACACTGCCTGGTCATGTACATCTTTCCCAACTTTCTGTTCCTGT[C/A]ATTCCTGTTCAATTTGGTGATGGTGCATTACGAGCGCTACCTCTGCATCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link