atad1a

Ensembl ID:
ENSDARG00000023267
ZFIN ID:
ZDB-GENE-030616-593
Description:
ATPase family AAA domain-containing protein 1-A [Source:UniProtKB/Swiss-Prot;Acc:Q7ZZ25]
Human Orthologue:
ATAD1
Human Description:
ATPase family, AAA domain containing 1 [Source:HGNC Symbol;Acc:25903]
Mouse Orthologue:
Atad1
Mouse Description:
ATPase family, AAA domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1915229]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15632 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15632
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035859 Essential Splice Site 337 380 9 10

The following transcripts of ENSDARG00000023267 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 18498440)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGATGAAACAGATCGCACAACAGTTCCAACTGGACGAAGAGGAAGAG[T/A]ATGTCTAATAYATTTTATATWACAYGCACATACACACAATTAACGCTTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hytwuuok