LOC568733

Ensembl ID:
ENSDARG00000023236
Human Orthologue:
KCNH1
Human Description:
potassium voltage-gated channel, subfamily H (eag-related), member 1 [Source:HGNC Symbol;Acc:6250]
Mouse Orthologue:
Kcnh1
Mouse Description:
potassium voltage-gated channel, subfamily H (eag-related), member 1 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24223 Essential Splice Site Mutation detected in F1 DNA During 2014
sa13182 Nonsense Available for shipment Available now
sa24224 Nonsense Mutation detected in F1 DNA During 2014
sa17935 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24223
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032246 Essential Splice Site 68 958 2 11
Genomic Location:
Chromosome 22 (position 40868518)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCCGGTTACCATCGTGCTGAAGTCATGCAGAAGAGCAGCACATGCAGG[T/C]GATTTCATGTTTCTGTTATTAATCATGTGACTGTATCCAATAGGGTTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13182
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032246 Nonsense 237 958 6 11
Genomic Location:
Chromosome 22 (position 40876464)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTGGGTGATCCTCATCCTCACCTTCTACACCGCCATCATGGTGCCCTA[C/A]AACGTGTCCTTTAAGACCAAGCAGAACAACGTCAMCTGGCTGGTGGTKGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24224
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032246 Nonsense 393 958 7 11
Genomic Location:
Chromosome 22 (position 40883814)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGTTATCGATCAAGACGCCAACATGGTGCGCACTGACAGCTGGCTGTA[T/A]CTGCTGGGCGAAGCTGTGGGTCAGCCCTATCACTTCAACGCCAGCGGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17935
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032246 Essential Splice Site 612 958 9 11
Genomic Location:
Chromosome 22 (position 40897292)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGGGGTCTTTGGAGGTCATCCAGGATGAWGAAGTTGTTGCAATTTTGGG[T/A]AAGTATGATTATACCAGTGCTCTTCGGTCTACTGYTACTTAGAGYTGCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/faluwl5m