selt2

Ensembl ID:
ENSDARG00000023220
ZFIN ID:
ZDB-GENE-030411-4
Description:
selenoprotein T2 precursor [Source:RefSeq peptide;Acc:NP_001091957]
Human Orthologue:
RP11-392O18.1
Human Description:
Selenoprotein T [Source:UniProtKB/Swiss-Prot;Acc:P62341]
Mouse Orthologue:
2810407C02Rik
Mouse Description:
RIKEN cDNA 2810407C02 gene Gene [Source:MGI Symbol;Acc:MGI:1916477]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11371 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11371
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006716 Essential Splice Site 171 210 None 7
ENSDART00000065002 Essential Splice Site 171 210 None 6
ENSDART00000143486 Essential Splice Site 171 210 None 6

The following transcripts of ENSDARG00000023220 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 15417948)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 17279934
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGAGACCCATTTCCTCTCAACAGGAGCTTTTGAGATTACACTGAATGG[T/C]AATCTCATTAGGATCACCACTATTCTCTTTAGGAAAAATATCTACTTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link