kpna4

Ensembl ID:
ENSDARG00000023190
ZFIN IDs:
ZDB-GENE-030131-5584, ZDB-GENE-030131-5584
Description:
importin subunit alpha-4 [Source:RefSeq peptide;Acc:NP_958462]
Human Orthologue:
KPNA4
Human Description:
karyopherin alpha 4 (importin alpha 3) [Source:HGNC Symbol;Acc:6397]
Mouse Orthologue:
Kpna4
Mouse Description:
karyopherin (importin) alpha 4 Gene [Source:MGI Symbol;Acc:MGI:1100848]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32009 Essential Splice Site Available for shipment Available now
sa30680 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32009
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034456 Essential Splice Site 38 521 2 17
ENSDART00000125797 Essential Splice Site 38 531 2 19
Genomic Location (Zv9):
Chromosome 15 (position 1612524)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1652409
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGACCATGAGAAGACAGCGGACAGAAGTGGTGGTGGAACTCAGAAAGG[T/C]AAGACTGGTTCATGCTTGTAAAATCAGCTGTTTGTGAAAGCACCAAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30680
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034456 Nonsense 231 521 9 17
ENSDART00000125797 Nonsense 231 531 9 19
Genomic Location (Zv9):
Chromosome 15 (position 1605391)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1645276
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACCTTCCTCCGTAACGTCACCTGGGTCATGGTCAACCTGTGCCGCCAC[A/T]AGGACCCTCCCCCGCCCATGGAGACCATCCAGGAGGTACAAATATGATGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link