tdo2b

Ensembl ID:
ENSDARG00000023176
ZFIN ID:
ZDB-GENE-030131-6014
Description:
Tryptophan 2,3-dioxygenase B [Source:UniProtKB/Swiss-Prot;Acc:Q7SY53]
Human Orthologue:
TDO2
Human Description:
tryptophan 2,3-dioxygenase [Source:HGNC Symbol;Acc:11708]
Mouse Orthologue:
Tdo2
Mouse Description:
tryptophan 2,3-dioxygenase Gene [Source:MGI Symbol;Acc:MGI:1928486]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4428 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4428
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028301 Nonsense 145 407 6 12
ENSDART00000138579 Nonsense 141 200 6 6
Genomic Location:
Chromosome 11 (position 34927850)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WGAGTGATTTATTTGCTCTATTATCTTTTGTTTGAATGTTATAGGGAGTA[T/A]CTGTCTCCAGCCTCGGGCTTCCAGAGTCTTCAGTTCCGTCTTCTGGAGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mlh6cvqc