ucp1

Ensembl ID:
ENSDARG00000023151
ZFIN ID:
ZDB-GENE-010503-1
Description:
mitochondrial uncoupling protein 3 [Source:RefSeq peptide;Acc:NP_955817]
Human Orthologues:
UCP1, UCP2, UCP3
Human Descriptions:
uncoupling protein 1 (mitochondrial, proton carrier) [Source:HGNC Symbol;Acc:12517]
uncoupling protein 2 (mitochondrial, proton carrier) [Source:HGNC Symbol;Acc:12518]
uncoupling protein 3 (mitochondrial, proton carrier) [Source:HGNC Symbol;Acc:12519]
Mouse Orthologues:
Ucp1, Ucp2, Ucp3
Mouse Descriptions:
uncoupling protein 1 (mitochondrial, proton carrier) Gene [Source:MGI Symbol;Acc:MGI:98894]
uncoupling protein 2 (mitochondrial, proton carrier) Gene [Source:MGI Symbol;Acc:MGI:109354]
uncoupling protein 3 (mitochondrial, proton carrier) Gene [Source:MGI Symbol;Acc:MGI:1099787]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19606 Essential Splice Site Available for shipment Available now
sa10943 Nonsense Available for shipment Available now
sa18447 Nonsense Available for shipment Available now
sa2013 Nonsense Mutation detected in F1 DNA During 2014
sa1981 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa19606
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038807 Essential Splice Site None 309 None 7

The following transcripts of ENSDARG00000023151 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 53870249)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCGGCCCGTCCCGTCCCGTCCCTCCAGCACACACAGATTACTGCCAGG[T/G]CAGAGGATTTTTATTCAGGATCGCACTGCGTTACTAATAATTGGACCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10943
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038807 Nonsense 88 309 3 7

The following transcripts of ENSDARG00000023151 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 53874360)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGAGGGTCCGCGCTCGCTCWACAACGGCCTGGTCGCCGGCCTACAGAGA[C/T]AGATGGCCTTCGCCTCCATCCGCATTGGCCTCTACGACAACGTCAAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18447
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038807 Nonsense 99 309 3 7

The following transcripts of ENSDARG00000023151 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 53874395)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCGGCCTACAGAGAYAGATGGCCTTCGCCTCCATCCGCATTGGCCTCTA[C/A]GACAACGTCAAGAGCTTCTAMACGCGTGGAAAAGACAGTCAGTCAAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2013
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038807 Nonsense 106 309 3 7

The following transcripts of ENSDARG00000023151 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 53874416)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTTCGCCTCCATCCGCATTGGCCTCTACGACAACGTCAAGAGCTTCTA[C/A]ACGCGTGGAAAAGACAGTCAGTCAAAAAGTCTCCTTCAGCAAACCGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1981
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038807 Essential Splice Site 212 309 6 7

The following transcripts of ENSDARG00000023151 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 53880657)
KASP Assay ID:
554-2777.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATCCCTATAACCGATTGCAATAGTAATGTATTGTCCCGTTTCTGCATGC[A/T]GACAATCTCCCGTGTCACTTTGTGTCTGCGTTCGGCGCGGGCTTCATCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/g5vneela