si:ch211-285e16.1

Ensembl ID:
ENSDARG00000023145
ZFIN IDs:
ZDB-GENE-030131-2074, ZDB-GENE-030131-2074, ZDB-GENE-081029-7
Description:
Pum1 protein [Source:UniProtKB/TrEMBL;Acc:Q7SXY5]
Human Orthologue:
PUM1
Human Description:
pumilio homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:14957]
Mouse Orthologue:
Pum1
Mouse Description:
pumilio 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1931749]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7463 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7463
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023947 Missense 399 540 9 13
ENSDART00000122308 Missense 399 1154 8 21
ENSDART00000127137 Missense 399 540 9 13
ENSDART00000143842 Missense 399 1042 9 20
Genomic Location (Zv9):
Chromosome 19 (position 44666883)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43494551
KASP Assay ID:
554-4087.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTTGGTGTGTTGTTGGTTGTGTGKAAGGTTTGGCTCCAGCTGCATTTG[T/C]ACCGAATCCGTACATCATCAGCGCTGCTCCGCCYGGCACCGACCCGTATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link