mapk7

Ensembl ID:
ENSDARG00000023110
ZFIN ID:
ZDB-GENE-050320-10
Description:
mitogen-activated protein kinase 7 [Source:RefSeq peptide;Acc:NP_001013469]
Human Orthologue:
MAPK7
Human Description:
mitogen-activated protein kinase 7 [Source:HGNC Symbol;Acc:6880]
Mouse Orthologue:
Mapk7
Mouse Description:
mitogen-activated protein kinase 7 Gene [Source:MGI Symbol;Acc:MGI:1346347]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35192 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35192
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042277 Nonsense 314 862 4 9
ENSDART00000133675 Nonsense 314 1080 4 7
ENSDART00000144881 Nonsense 314 862 4 9
Genomic Location (Zv9):
Chromosome 12 (position 4907226)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4189948
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGCTGATTCTTTCAGTTTTAGGGACGCCACCCGAAAGCATTGTTGGCT[C/A]AATTGGGTCAGATAGGGTGCGCTCTTATGTGCGGAGCCTTCCATCCAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link