scaper

Ensembl ID:
ENSDARG00000023104
ZFIN ID:
ZDB-GENE-060303-5
Description:
S phase cyclin A-associated protein in the ER [Source:RefSeq peptide;Acc:NP_001116519]
Human Orthologue:
SCAPER
Human Description:
S-phase cyclin A-associated protein in the ER [Source:HGNC Symbol;Acc:13081]
Mouse Orthologue:
Scaper
Mouse Description:
S phase cyclin A-associated protein in the ER Gene [Source:MGI Symbol;Acc:MGI:1925976]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3292 Nonsense F2 line generated During 2017
sa12343 Essential Splice Site Available for shipment Available now
sa25235 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38119 Splice Site Mutation detected in F1 DNA During 2017
sa44341 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa3292
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035382 Nonsense 452 1551 8 31
ENSDART00000103324 Nonsense 328 1318 8 30
Genomic Location (Zv9):
Chromosome 25 (position 33546662)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32157064
KASP Assay ID:
554-2488.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCAAGAYAAATCTCAGGACGTGAGGGAGCAAGAGCCACCCATACCCCAA[G/T]AGCCCAGCAAAGAGATGGAAAAGACCCCGGTCATCGAGGTAATGACGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12343
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035382 Essential Splice Site 953 1551 18 31
ENSDART00000103324 Essential Splice Site 720 1318 17 30
Genomic Location (Zv9):
Chromosome 25 (position 33567891)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32178293
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ARCTCACACCGTATGARCGGAAGAAGCAGTGCTCGCTCTGTAACGTTGTG[G/A]TAAGTACWGCATTATGGGATGCGTYAKGATTATATAARGAGCAGATAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25235
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035382 Essential Splice Site 1057 1551 21 31
ENSDART00000103324 Essential Splice Site 824 1318 20 30
Genomic Location (Zv9):
Chromosome 25 (position 33600018)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32210420
KASP Assay ID:
554-7761.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGCATGGAAGCCAAAAGCCAGACCTCCGACTCTCCGTACAAGGCCAAG[T/G]AAGCCCCCCCTGCTCTGCTTTTTAAGGATCATATACCCAAACAGGGGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38119
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035382 Splice Site None 1551 None 31
ENSDART00000103324 Splice Site None 1318 None 30
Genomic Location (Zv9):
Chromosome 25 (position 33601750)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32212152
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACAGAACTCTTGGGGAGATCTCACGAATTCTAGAAAAACAGGTTTGTT[C/A]ATCTCTCTCAGGTCTCGTTTGCGCTAGTGCGTTTTAGTTTAAAACAGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44341
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035382 Nonsense 1272 1551 26 31
ENSDART00000103324 Nonsense 1039 1318 25 30
Genomic Location (Zv9):
Chromosome 25 (position 33663815)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32274127
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGAACGTGGGCTTGATTGACAAGTTGTACGGCTGCTTCCTGTCCATA[C/T]AAGGGCCAATCGATGAGAGTCCCAAGATGGCTGCCTTTCTGGAGCAAGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link