krt1-19d

Ensembl ID:
ENSDARG00000023082
ZFIN ID:
ZDB-GENE-060316-1
Description:
Novel protein similar to vertebrate keratin family [Source:UniProtKB/TrEMBL;Acc:Q1LXK0]
Human Orthologues:
KRT14, KRT16, KRT20, KRT23
Human Descriptions:
keratin 14 [Source:HGNC Symbol;Acc:6416]
keratin 16 [Source:HGNC Symbol;Acc:6423]
keratin 20 [Source:HGNC Symbol;Acc:20412]
keratin 23 (histone deacetylase inducible) [Source:HGNC Symbol;Acc:6438]
Mouse Orthologues:
Krt14, Krt16, Krt20, Krt23
Mouse Descriptions:
keratin 14 Gene [Source:MGI Symbol;Acc:MGI:96688]
keratin 16 Gene [Source:MGI Symbol;Acc:MGI:96690]
keratin 20 Gene [Source:MGI Symbol;Acc:MGI:1914059]
keratin 23 Gene [Source:MGI Symbol;Acc:MGI:2148866]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa913 Nonsense Available for shipment Available now
sa44903 Nonsense Mutation detected in F1 DNA During 2017
sa23425 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa913
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010373 Nonsense 141 423 2 8
ENSDART00000105042 Nonsense 155 415 2 9
Genomic Location (Zv9):
Chromosome 19 (position 5955282)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5414593
KASP Assay ID:
554-0819.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTMATTTTAGTTTATTTGTTTCTCCAGATCATGGCAGSCATTCATCTG[A/T]AGGGTGGACTCCATCTCAGCATCGACAACACCAGTCTGGCCATGAATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44903
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010373 Nonsense 356 423 7 8
ENSDART00000105042 Nonsense 370 415 7 9
Genomic Location (Zv9):
Chromosome 19 (position 5949241)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCAGATAGTGCAGCTCCGAGCTGATCTGGAGCGCCAACGTCATGATTA[T/G]CAGATGCTTCTGGACATCAAGGCCAGACTGGAGATGGAGATCGCAGAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23425
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010373 Essential Splice Site 382 423 None 8
ENSDART00000105042 Essential Splice Site 396 415 None 9
Genomic Location (Zv9):
Chromosome 19 (position 5949063)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5408374
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAATTAAAAGAAAATATGATACTTAAAATAACTATTGTGTTTCTTCTAC[A/T]GTGTCAAAACAACCTCCAGTTCCACCTCGAGAACAAAAGTCATCACAGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification of 15 loci influencing height in a Korean population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link