krt1-19d

Ensembl ID:
ENSDARG00000023082
ZFIN ID:
ZDB-GENE-060316-1
Description:
Novel protein similar to vertebrate keratin family [Source:UniProtKB/TrEMBL;Acc:Q1LXK0]
Human Orthologues:
KRT14, KRT16, KRT20, KRT23
Human Descriptions:
keratin 14 [Source:HGNC Symbol;Acc:6416]
keratin 16 [Source:HGNC Symbol;Acc:6423]
keratin 20 [Source:HGNC Symbol;Acc:20412]
keratin 23 (histone deacetylase inducible) [Source:HGNC Symbol;Acc:6438]
Mouse Orthologues:
Krt14, Krt16, Krt20, Krt23
Mouse Descriptions:
keratin 14 Gene [Source:MGI Symbol;Acc:MGI:96688]
keratin 16 Gene [Source:MGI Symbol;Acc:MGI:96690]
keratin 20 Gene [Source:MGI Symbol;Acc:MGI:1914059]
keratin 23 Gene [Source:MGI Symbol;Acc:MGI:2148866]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa913 Nonsense Available for shipment Available now
sa23425 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa913
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010373 Nonsense 141 423 2 8
ENSDART00000105042 Nonsense 155 415 2 9
Genomic Location:
Chromosome 19 (position 5955282)
KASP Assay ID:
554-0819.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTMATTTTAGTTTATTTGTTTCTCCAGATCATGGCAGSCATTCATCTG[A/T]AGGGTGGACTCCATCTCAGCATCGACAACACCAGTCTGGCCATGAATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23425
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010373 Essential Splice Site 382 423 None 8
ENSDART00000105042 Essential Splice Site 396 415 None 9
Genomic Location:
Chromosome 19 (position 5949063)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAATTAAAAGAAAATATGATACTTAAAATAACTATTGTGTTTCTTCTAC[A/T]GTGTCAAAACAACCTCCAGTTCCACCTCGAGAACAAAAGTCATCACAGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification of 15 loci influencing height in a Korean population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2bge2xkl