foxo3a

Ensembl ID:
ENSDARG00000023058
ZFIN ID:
ZDB-GENE-050116-1
Description:
forkhead box O3A [Source:RefSeq peptide;Acc:NP_001009988]
Human Orthologue:
FOXO3
Human Description:
forkhead box O3 [Source:HGNC Symbol;Acc:3821]
Mouse Orthologue:
Foxo3
Mouse Description:
forkhead box O3 Gene [Source:MGI Symbol;Acc:MGI:1890081]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15218 Essential Splice Site Available for shipment Available now
sa22992 Nonsense Mutation detected in F1 DNA During 2014
sa7442 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15218
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030773 Essential Splice Site 190 643 1 2
Genomic Location:
Chromosome 17 (position 6557981)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCATACTTCAAGGACAAAGGTGACAGCAACAGCTCTGCAGGATGGAAGG[T/C]ACGTCAGGTCAAATRTTTTAACCTTGGCTTCCTTTTAACCCTTTATCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22992
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030773 Nonsense 245 643 2 2
Genomic Location:
Chromosome 17 (position 6570278)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCTCCACGCAGGCGTGCAGTATCAATGGACAACAGTAATAAGCTCATC[A/T]AGAGCGCCCGTGGCCGTGCCGCAAAGAAGAAAGCCGCTCTGCAGGCATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7442
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030773 Missense 593 643 2 2
Genomic Location:
Chromosome 17 (position 6571324)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTCATCTGACTTGGATCTTKAGGCATTCAGTGGCAGTTTCGATTGCGA[T/A]ATGGACATCATAACYCGCAACGATCTGATGGATGCCGAAGGCCTGGAGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v520s7my