hoxa2b

Ensembl ID:
ENSDARG00000023031
ZFIN ID:
ZDB-GENE-990415-98
Description:
Homeobox protein Hox-A2b [Source:UniProtKB/Swiss-Prot;Acc:O42365]
Human Orthologue:
HOXA2
Human Description:
homeobox A2 [Source:HGNC Symbol;Acc:5103]
Mouse Orthologue:
Hoxa2
Mouse Description:
homeobox A2 Gene [Source:MGI Symbol;Acc:MGI:96174]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36100 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36100
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009827 Essential Splice Site 120 363 1 2
Genomic Location (Zv9):
Chromosome 16 (position 23011917)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21121668
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGACAGCGGCAACCACCGACCCTGGTCCACTATACTTCTCCCCTCAAG[G/A]TATTTGGATTTTTAAATAATGTTATTATTTTATATTTGACTCCAAACAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link