cdv3

Ensembl ID:
ENSDARG00000023028
ZFIN ID:
ZDB-GENE-030131-6034
Description:
Protein CDV3 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q7T370]
Human Orthologue:
CDV3
Human Description:
CDV3 homolog (mouse) [Source:HGNC Symbol;Acc:26928]
Mouse Orthologue:
Cdv3
Mouse Description:
carnitine deficiency-associated gene expressed in ventricle 3 Gene [Source:MGI Symbol;Acc:MGI:244875

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10726 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10726
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036204 Nonsense 123 236 3 5
ENSDART00000124609 Nonsense 123 236 3 6
Genomic Location:
Chromosome 24 (position 9690324)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTGGGTGAGGATGGCGAGATCATCTTGGTCACCAGTGATAAAATGTCT[G/T]GACCCTGGAATAAATCAGGGGGGGCTCCTCCTTCAGCTGCTTCAGCTCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hapt4in5