SETX

Ensembl ID:
ENSDARG00000022996
Description:
senataxin [Source:HGNC Symbol;Acc:445]
Human Orthologue:
SETX
Human Description:
senataxin [Source:HGNC Symbol;Acc:445]
Mouse Orthologue:
Setx
Mouse Description:
senataxin Gene [Source:MGI Symbol;Acc:MGI:2443480]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32326 Nonsense Available for shipment Available now
sa11606 Nonsense Available for shipment Available now
sa37214 Nonsense Mutation detected in F1 DNA During 2017
sa29496 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32326
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082314 Nonsense 151 2368 3 24
Genomic Location (Zv9):
Chromosome 21 (position 4229713)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3784371
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACAGCTGATATGGTGGTTAGGGTCTTGTACAAGTTGCAGGATTGGCAG[C/T]AAACTTTGAGTTGGTCTGAGAAGTATCAGGGAACATATCTGCTTCTCGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11606
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082314 Nonsense 472 2368 8 24
Genomic Location (Zv9):
Chromosome 21 (position 4225983)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3788101
KASP Assay ID:
2261-5144.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AARCAAGCGTGTGTGATAAAGTGACTGAGCTCTTTGCTCGTATCTTTATT[C/T]AAATCGTTGAGCTACACTATACCGAAGGACAAATGGGAATACTTTCTCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37214
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082314 Nonsense 882 2368 8 24
Genomic Location (Zv9):
Chromosome 21 (position 4224752)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3789332
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAATATGTGGCATCTGCTTGGGATAATGCAGATTTGGATGGATCAGTCT[T/A]GACAAAGAATCTCAAATCAGATCGAATACTCAAGCCACAGTTGGATGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29496
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082314 Essential Splice Site 1764 2368 12 24
Genomic Location (Zv9):
Chromosome 21 (position 4220559)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3793525
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGAAGAGTAAAACAATTGGTGGTCTGTTGTACAAACTTCTGTCTTCGG[T/C]ACTTATTTTCCCATCTGAATGCATCTTTATTTCTCCATACTCTGCATGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link