epha6

Ensembl ID:
ENSDARG00000022971
ZFIN ID:
ZDB-GENE-090311-43
Description:
Ephrin receptor [Source:UniProtKB/TrEMBL;Acc:B8A674]
Human Orthologue:
EPHA6
Human Description:
EPH receptor A6 [Source:HGNC Symbol;Acc:19296]
Mouse Orthologue:
Epha6
Mouse Description:
Eph receptor A6 Gene [Source:MGI Symbol;Acc:MGI:108034]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13485 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13485
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042984 Nonsense 443 996 6 18
ENSDART00000146042 None None 213 None 6
ENSDART00000146530 Nonsense 443 985 6 17
Genomic Location:
Chromosome 1 (position 33809159)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACTAATTGTTTTTGTCYTTTAGGTCCGTCTCTGGTAGGTGTGGTGAGA[A/T]AAGACTGGGCATCTCAAACTAGTGTYGCCCTCTCATGGCAGGAAACTGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/roajvu0r