epha6

Ensembl ID:
ENSDARG00000022971
ZFIN ID:
ZDB-GENE-090311-43
Description:
Ephrin receptor [Source:UniProtKB/TrEMBL;Acc:B8A674]
Human Orthologue:
EPHA6
Human Description:
EPH receptor A6 [Source:HGNC Symbol;Acc:19296]
Mouse Orthologue:
Epha6
Mouse Description:
Eph receptor A6 Gene [Source:MGI Symbol;Acc:MGI:108034]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39638 Nonsense Mutation detected in F1 DNA During 2016
sa13485 Nonsense Available for shipment Available now
sa38274 Nonsense Mutation detected in F1 DNA During 2016
sa39639 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa39638
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042984 Nonsense 285 996 4 18
ENSDART00000146042   None 213 None 6
ENSDART00000146530 Nonsense 285 985 4 17
Genomic Location (Zv9):
Chromosome 1 (position 33767357)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 33402108
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGCCTGCAGACCTGGGTTCTACAAAGCCTTTGCAGGAAACATTAAATG[T/A]TCAAAGTGTCCCCCGCACAGCTCCAGCCACGCCGAGGGTTCAGCACAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13485
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042984 Nonsense 443 996 6 18
ENSDART00000146042   None 213 None 6
ENSDART00000146530 Nonsense 443 985 6 17
Genomic Location (Zv9):
Chromosome 1 (position 33809159)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 33443910
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACTAATTGTTTTTGTCYTTTAGGTCCGTCTCTGGTAGGTGTGGTGAGA[A/T]AAGACTGGGCATCTCAAACTAGTGTYGCCCTCTCATGGCAGGAAACTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38274
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042984 Nonsense 480 996 7 18
ENSDART00000146042   None 213 None 6
ENSDART00000146530 Nonsense 480 985 7 17
Genomic Location (Zv9):
Chromosome 1 (position 33809347)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 33444098
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGTAGGTTAAATCGTTTCCTTTTTCACTTGTTTAGGAACAGGAACAGT[T/A]AAGTTATTCATCTACACGTACAAAATCTCCAAGCGTGATAGTGACAGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39639
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042984 Essential Splice Site 784 996 13 18
ENSDART00000146042 Essential Splice Site 159 213 4 6
ENSDART00000146530 Essential Splice Site 784 985 13 17
Genomic Location (Zv9):
Chromosome 1 (position 33821758)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 33456509
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTCCAGGGTGCTGGAGGACGACCCGGAGGCAGCTTACACCACCACAG[T/A]AAGCCACACATGCACCCTCTTCATTTACATTCAGGCCTGTTCACAGTTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link