tm9sf1

Ensembl ID:
ENSDARG00000022970
ZFIN ID:
ZDB-GENE-040801-64
Description:
transmembrane 9 superfamily member 1 [Source:RefSeq peptide;Acc:NP_001003550]
Human Orthologues:
RP11-468E2.1, TM9SF1
Human Descriptions:
transmembrane 9 superfamily member 1 isoform a [Source:RefSeq peptide;Acc:NP_006396]
transmembrane 9 superfamily member 1 [Source:HGNC Symbol;Acc:11864]
Mouse Orthologue:
Tm9sf1
Mouse Description:
transmembrane 9 superfamily member 1 Gene [Source:MGI Symbol;Acc:MGI:1921390]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24455 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24455
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033621 Nonsense 93 609 3 9
Genomic Location:
Chromosome 24 (position 11678033)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAGTCTGGGAGAGGTGTTGGATGGAGACCGTATGGCTGAATCTCTTTA[T/G]AACATCCGTTTCAAGGAAAATGCAGATAGACTGACGCTGTGCAAGCTCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t91wgfu8