fxr1

Ensembl ID:
ENSDARG00000022968
ZFIN IDs:
ZDB-GENE-030131-5431, ZDB-GENE-030131-5431
Description:
fragile X mental retardation syndrome-related protein 1 [Source:RefSeq peptide;Acc:NP_958458]
Human Orthologue:
FXR1
Human Description:
fragile X mental retardation, autosomal homolog 1 [Source:HGNC Symbol;Acc:4023]
Mouse Orthologue:
Fxr1
Mouse Description:
fragile X mental retardation gene 1, autosomal homolog Gene [Source:MGI Symbol;Acc:MGI:104860]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24220 Nonsense Available for shipment Available now
sa24219 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24220
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104478 Nonsense 31 622 2 16
ENSDART00000104480 Nonsense 31 648 2 17
Genomic Location (Zv9):
Chromosome 22 (position 40547480)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 37626856
KASP Assay ID:
2261-7102.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATTCCAGGGCTTTGTCAGAGACGTTCACGATGACTCGCTCTCCATTT[C/A]GTTCGAGAATAAGTGAGTAGAAGCAAACAGTTGAATTGTAATACAGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24219
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104478 Essential Splice Site 557 622 14 16
ENSDART00000104480 Essential Splice Site 557 648 14 17
Genomic Location (Zv9):
Chromosome 22 (position 40536561)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 37615937
KASP Assay ID:
2261-7099.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGGCATGAGCGAGTCTGACAACGCCTCACTCAGCGAGAACGGCCTCGG[T/C]AAAAACAACTACAACACATTGATTTGATTTAGTCATTCTTTTGCAAGGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Schizophrenia: Common polygenic variation contributes to risk of schizophrenia and bipolar disorder. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link