fxr1

Ensembl ID:
ENSDARG00000022968
ZFIN IDs:
ZDB-GENE-030131-5431, ZDB-GENE-030131-5431
Description:
fragile X mental retardation syndrome-related protein 1 [Source:RefSeq peptide;Acc:NP_958458]
Human Orthologue:
FXR1
Human Description:
fragile X mental retardation, autosomal homolog 1 [Source:HGNC Symbol;Acc:4023]
Mouse Orthologue:
Fxr1
Mouse Description:
fragile X mental retardation gene 1, autosomal homolog Gene [Source:MGI Symbol;Acc:MGI:104860]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24220 Nonsense Mutation detected in F1 DNA During 2014
sa24219 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24220
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104478 Nonsense 31 622 2 16
ENSDART00000104480 Nonsense 31 648 2 17
Genomic Location:
Chromosome 22 (position 40547480)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATTCCAGGGCTTTGTCAGAGACGTTCACGATGACTCGCTCTCCATTT[C/A]GTTCGAGAATAAGTGAGTAGAAGCAAACAGTTGAATTGTAATACAGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24219
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104478 Essential Splice Site 557 622 14 16
ENSDART00000104480 Essential Splice Site 557 648 14 17
Genomic Location:
Chromosome 22 (position 40536561)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGGCATGAGCGAGTCTGACAACGCCTCACTCAGCGAGAACGGCCTCGG[T/C]AAAAACAACTACAACACATTGATTTGATTTAGTCATTCTTTTGCAAGGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Schizophrenia: Common polygenic variation contributes to risk of schizophrenia and bipolar disorder. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xth69oyw