pth2

Ensembl ID:
ENSDARG00000022951
ZFIN ID:
ZDB-GENE-041102-1
Description:
tuberoinfundibular peptide of 39 amino acids [Source:RefSeq peptide;Acc:NP_991140]
Human Orthologue:
PTH2
Human Description:
parathyroid hormone 2 [Source:HGNC Symbol;Acc:30828]
Mouse Orthologue:
Pth2
Mouse Description:
parathyroid hormone 2 Gene [Source:MGI Symbol;Acc:MGI:2152297]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23129 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23129
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033691 Nonsense 55 157 3 3
Genomic Location (Zv9):
Chromosome 17 (position 33704036)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 33545767
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGCAATTGGTCAAGAAGACTCCAAAGGTGAGCAGTGGGAGGTGGTGTA[T/A]CCATCCATCTCGCTCCGTGATTGGAGCATTCAGATGCTGACCGCCCCTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link