arl4a

Ensembl ID:
ENSDARG00000022934
ZFIN ID:
ZDB-GENE-040426-1878
Description:
ADP-ribosylation factor-like 4 [Source:RefSeq peptide;Acc:NP_957154]
Human Orthologue:
ARL4A
Human Description:
ADP-ribosylation factor-like 4A [Source:HGNC Symbol;Acc:695]
Mouse Orthologue:
Arl4a
Mouse Description:
ADP-ribosylation factor-like 4A Gene [Source:MGI Symbol;Acc:MGI:99437]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14910 Nonsense Available for shipment Available now
sa11476 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14910
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031535 Nonsense 67 200 2 2
Genomic Location:
Chromosome 15 (position 31800231)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CRACCAGAGGCTTCAATGCTGAGAAAGTCMGAATACCAGTTGGGGACTCA[C/T]GAACAGTGACGTTTCATTTTTGGGATGTTGGGGGCCAGGAGAAACTGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11476
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031535 Nonsense 165 200 2 2
Genomic Location:
Chromosome 15 (position 31799937)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACCATGCTGGCACTCAAYGAACTGGGACCCTCTACACCGTGGCWTTTG[C/T]AGCCCACTTGYGCCATCATTGGYGACGGCCTAAAAGAGGGACTGGAAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/59o58fae