A3KNT4_DANRE

Ensembl ID:
ENSDARG00000022918
Description:
Tbccl protein [Source:UniProtKB/TrEMBL;Acc:A3KNT4]
Human Orthologue:
TBCC
Human Description:
tubulin folding cofactor C [Source:HGNC Symbol;Acc:11580]
Mouse Orthologue:
Tbcc
Mouse Description:
tubulin-specific chaperone C Gene [Source:MGI Symbol;Acc:MGI:1919976]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15709 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15709
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015643 Nonsense 116 353 1 1
Genomic Location:
Chromosome 12 (position 36431524)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YCCAGAAGTTCCTCAATGACAGTGTGAGGTTTCTAACCCAATATGAAATA[C/T]GACAAGCACAGGAATCCCTGCAGAAACTCCAAAGCTCCATTWCTGACAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dav6thzy