si:dkey-20i20.12

Ensembl ID:
ENSDARG00000022905
ZFIN ID:
ZDB-GENE-060503-151
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A3KPV1]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29693 Essential Splice Site Mutation detected in F1 DNA During 2017
sa17376 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa29693
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042770 Essential Splice Site None 251 1 4
Genomic Location (Zv9):
Chromosome 22 (position 1958486)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2699576
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACGTCAGCACTGACGCGTTCATTTAGCGTCGAGTCTTCAGAGCTGAGG[T/G]GAGTCGTTGACGCTTTTTCTCGTGTTTACACAACAATAAAACACACTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17376
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042770 Nonsense 171 251 4 4
Genomic Location (Zv9):
Chromosome 22 (position 1961316)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2702406
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCGTACACAKGTGCCGAGTGTGGGAGGAGTTTTAAACAACTGTCGAATT[T/G]AAAAGTACATCATAAGATCCACACTGGAGAGAAACCGAACRCATGCGAKC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link