mcf2

Ensembl ID:
ENSDARG00000022895
ZFIN ID:
ZDB-GENE-030616-52
Human Orthologue:
MCF2
Human Description:
MCF.2 cell line derived transforming sequence [Source:HGNC Symbol;Acc:6940]
Mouse Orthologue:
Mcf2
Mouse Description:
mcf.2 transforming sequence Gene [Source:MGI Symbol;Acc:MGI:96932]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28332 Nonsense Mutation detected in F1 DNA During 2015
sa11503 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa28332
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034883 Nonsense 455 1111 12 30
Genomic Location:
Chromosome 14 (position 33347807)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGTGATGATGGGGCTTATTTGTTGGCTAATCAGCAGGTAGAGAAATG[C/A]CAGTGTAAAGAGGGTGCACAGACAGCTCTGCGAGATATTGAGAAGTTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11503
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034883 Nonsense 926 1111 24 30
Genomic Location:
Chromosome 14 (position 33325610)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGGTAAAGATCGCCTGGCTGAATGAAATCAGAAAGATCCTGACCAAC[C/T]AGCAGAAACAGCTCAAAGGTCTYAACACATCACATTKCCTGTGATTTAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kpdnixea