mcf2

Ensembl ID:
ENSDARG00000022895
ZFIN ID:
ZDB-GENE-030616-52
Human Orthologue:
MCF2
Human Description:
MCF.2 cell line derived transforming sequence [Source:HGNC Symbol;Acc:6940]
Mouse Orthologue:
Mcf2
Mouse Description:
mcf.2 transforming sequence Gene [Source:MGI Symbol;Acc:MGI:96932]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35715 Essential Splice Site Mutation detected in F1 DNA During 2016
sa28332 Nonsense Mutation detected in F1 DNA During 2016
sa11503 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35715
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034883 Essential Splice Site 252 1111 7 30
Genomic Location:
Chromosome 14 (position 33354093)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATTGAGTTCCTCTTGCTATCCCACACTGAGAAATACAGGAGGCTTAAG[G/A]TAATTTAATGGTTGTGCATTTGCAACTTTAACACTCAACAGTTACTGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28332
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034883 Nonsense 455 1111 12 30
Genomic Location:
Chromosome 14 (position 33347807)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGTGATGATGGGGCTTATTTGTTGGCTAATCAGCAGGTAGAGAAATG[C/A]CAGTGTAAAGAGGGTGCACAGACAGCTCTGCGAGATATTGAGAAGTTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11503
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034883 Nonsense 926 1111 24 30
Genomic Location:
Chromosome 14 (position 33325610)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGGTAAAGATCGCCTGGCTGAATGAAATCAGAAAGATCCTGACCAAC[C/T]AGCAGAAACAGCTCAAAGGTCTYAACACATCACATTKCCTGTGATTTAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link