LOC798087

Ensembl ID:
ENSDARG00000022853
Human Orthologue:
C3orf64
Human Description:
chromosome 3 open reading frame 64 [Source:HGNC Symbol;Acc:28526]
Mouse Orthologue:
A130022J15Rik
Mouse Description:
RIKEN cDNA A130022J15 gene Gene [Source:MGI Symbol;Acc:MGI:2141669]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4412 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4412
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047735 Essential Splice Site 328 521 11 18
Genomic Location:
Chromosome 11 (position 18234059)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGAGATTGAGCTCATCTGGTGCTGTCACTCAAATCAGCCCTCTATTAA[T/A]GATTCTCTGTGTGCAAATGACATGTGGAGAAGCTTTAACTGACAGNNNTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/heb0qy3j