PTK2B (1 of 2)

Ensembl ID:
ENSDARG00000022841
Description:
PTK2B protein tyrosine kinase 2 beta [Source:HGNC Symbol;Acc:9612]
Human Orthologue:
PTK2B
Human Description:
PTK2B protein tyrosine kinase 2 beta [Source:HGNC Symbol;Acc:9612]
Mouse Orthologue:
Ptk2b
Mouse Description:
PTK2 protein tyrosine kinase 2 beta Gene [Source:MGI Symbol;Acc:MGI:104908]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22987 Nonsense Available for shipment Available now
sa36298 Nonsense Mutation detected in F1 DNA During 2017
sa13889 Nonsense Available for shipment Available now
sa2896 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa22987
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028407 Nonsense 301 933 9 29
Genomic Location (Zv9):
Chromosome 17 (position 5925475)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6004411
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAATTCGAAGTATTAAATGCACACATCAGAACGATGGAAAGGCACTGT[T/A]ACATATCAATATAGAAGGAGCTAAACAGGTAAATGCATCTGTCTTTAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36298
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028407 Nonsense 384 933 13 29
Genomic Location (Zv9):
Chromosome 17 (position 5918223)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 5997159
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATCTCTCGTTGTTTTTTGCAGATTCAGATATTTATGCAGAGATACCC[G/T]AAGAAAAACCACTTGCAGGTAAGAACCAAATAATGATTTATGCTTTAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13889
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028407 Nonsense 602 933 20 29
Genomic Location (Zv9):
Chromosome 17 (position 5907705)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 5986641
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGTGTGTATGTGGGAGATCATGAGCGGAGGTCAGCAGCCGYTCTTCTG[G/A]CTGGAGAATAAAGATGTGAWCAACCAATTGGAGCAGGGCATGCGTCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2896
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028407 Essential Splice Site 755 933 24 29
Genomic Location (Zv9):
Chromosome 17 (position 5894204)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 5973140
KASP Assay ID:
554-2539.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAATTCTGACTTCATCTGTAGCAAGTCACCTTTTCTTGTTTCTCGTTTA[G/A]GTTCCGTTTGCTAATGAAGACATGAAAACGAAAGCGGTAAAGCTTATCTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link