LOC100148604

Ensembl ID:
ENSDARG00000022810
Human Orthologue:
FZR1
Human Description:
fizzy/cell division cycle 20 related 1 (Drosophila) [Source:HGNC Symbol;Acc:24824]
Mouse Orthologue:
Fzr1
Mouse Description:
fizzy/cell division cycle 20 related 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1926790]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32837 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39761 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32837
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029552 Essential Splice Site 150 485 5 14
Genomic Location (Zv9):
Chromosome 2 (position 5776671)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 6222399
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGACAATGAAATCTCACCTTATTCCCTCTCGCCTCTTAGTAACAAAAG[G/A]TATGATTCTTCTCTGATCTCTGCATATGATGGAGCCAGTAATCAATCGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39761
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029552 Essential Splice Site 472 485 13 14
Genomic Location (Zv9):
Chromosome 2 (position 5789676)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 6235404
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGAAACACTACGCTTCTGGAACGTCTTCAGCAAAACACGCTGCACCAAG[G/A]TCGGCTGAGAGTCTTGGGTCTCGCTGGCTTTTAAAGGGATTGTTCACATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link