si:ch211-106a19.1

Ensembl ID:
ENSDARG00000022772
ZFIN ID:
ZDB-GENE-060526-3
Description:
oxysterol-binding protein 2 [Source:RefSeq peptide;Acc:NP_001116220]
Human Orthologue:
OSBP2
Human Description:
oxysterol binding protein 2 [Source:HGNC Symbol;Acc:8504]
Mouse Orthologue:
Osbp2
Mouse Description:
oxysterol binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1921559]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33593 Essential Splice Site Mutation detected in F1 DNA During 2017
sa20410 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33593
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033630 Essential Splice Site 387 808 7 14
ENSDART00000139522   None 153 None 2

The following transcripts of ENSDARG00000022772 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 26253624)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 24080889
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATTTTTTAATACAAACACTCTCGGCTCTCTCTCTCTCTGTCTTTTTT[A/C]GTGTTCTGTGAGCAGTAATGACTTTTCAGGGAAAGAGCTGCAGCCTCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20410
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033630 Essential Splice Site 688 808 12 14
ENSDART00000139522   None 153 None 2

The following transcripts of ENSDARG00000022772 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 26244391)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 24071656
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTATCAGACCCTCTCACCCAAACTGCTGTGGAAGAAATACCCTCTACC[G/T]TAAGACACTCCCATCAAATATCAGTCATGATGACACTCAAAAACCTGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link