apobl

Ensembl ID:
ENSDARG00000022767
ZFIN ID:
ZDB-GENE-030131-9732
Description:
apolipoprotein B, like [Source:RefSeq peptide;Acc:NP_001025233]
Human Orthologue:
APOB
Human Description:
apolipoprotein B (including Ag(x) antigen) [Source:HGNC Symbol;Acc:603]
Mouse Orthologue:
Apob
Mouse Description:
apolipoprotein B Gene [Source:MGI Symbol;Acc:MGI:88052]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18137 Nonsense Available for shipment Available now
sa12118 Nonsense Available for shipment Available now
sa16833 Nonsense Available for shipment Available now
sa6637 Nonsense Mutation detected in F1 DNA During 2014
sa6638 Nonsense Mutation detected in F1 DNA During 2014
sa10039 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18137
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028709 Nonsense 1336 3730 23 27
ENSDART00000133353 Nonsense 1336 3730 23 27
Genomic Location:
Chromosome 20 (position 31302873)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCCATGATTGAAGTCACRGGAACAAGTCCAGTGGATCTACTCTCCTTC[A/T]AAATAGAAGGTACTTGTATGYTTTCATATTTTCTGTTAATCACNTTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12118
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028709 Nonsense 1967 3730 24 27
ENSDART00000133353 Nonsense 1967 3730 24 27
Genomic Location:
Chromosome 20 (position 31304855)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATATCAACAGAGAAGAAATCATTGTAGAAATTCAGAAACTGGCCACATA[T/A]GTTAGTGACTTTGTGAATGAACTGAATCTGGAAGAGAAAATCATAAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16833
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028709 Nonsense 2304 3730 24 27
ENSDART00000133353 Nonsense 2304 3730 24 27
Genomic Location:
Chromosome 20 (position 31305866)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACTTGAAATCCGTCAAAAGCTTGAGGCAATCAGAGAGTTTGTTAACTA[T/A]GCTTTGTCATCTATGWGCGCTTGCATCGAAAAGCTGGAAAAAGTCAAART
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6637
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028709 Nonsense 2696 3730 24 27
ENSDART00000133353 Nonsense 2696 3730 24 27
Genomic Location:
Chromosome 20 (position 31307040)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCCCTGGCAGGTGGAATATCTGCAAATATCAAAACAACATATAATGAC[A/T]AGTTAAATGCAGWCCTTTGGAACAGTGAATATTATTACGGTAATGATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6638
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028709 Nonsense 2875 3730 24 27
ENSDART00000133353 Nonsense 2875 3730 24 27
Genomic Location:
Chromosome 20 (position 31307579)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAACCTTGTAGAGCCCCTGTCTGCTAAGATTGATCTTCAGAACAATTA[T/A]ACTGTCATCCTTAATAGCGACGAGCAGATGTTGAGCACTGGGTTACTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10039
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028709 Nonsense 3214 3730 24 27
ENSDART00000133353 Nonsense 3214 3730 24 27
Genomic Location:
Chromosome 20 (position 31308596)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTYGATGTGGATGAAAACCTGTCTGTAGAGACAGCCAATGAGCAYGTATA[T/A]GCTACAATGAAGTTTACTTCCAATAATGAAGCAARTGTTGGATCTTTCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4404871d