B1A3A2_DANRE

Ensembl ID:
ENSDARG00000022739
Description:
Relaxin family peptide receptor 3 [Source:UniProtKB/TrEMBL;Acc:B1A3A2]
Human Orthologue:
RXFP3
Human Description:
relaxin/insulin-like family peptide receptor 3 [Source:HGNC Symbol;Acc:24883]
Mouse Orthologue:
Rxfp3
Mouse Description:
relaxin family peptide receptor 3 Gene [Source:MGI Symbol;Acc:MGI:2441827]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8816 Nonsense Mutation detected in F1 DNA During 2017
sa19903 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8816
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028693 Nonsense 12 398 1 1
Genomic Location (Zv9):
Chromosome 2 (position 53782785)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 53334512
KASP Assay ID:
2259-2759.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCGTAAAGCCGTGCCATGCAGGGGAACAGCAGCGCGTTGGCACCGGGYT[T/A]AGCGTCGTGCGGTCCGGCTTTATATGAGAGCGATGCRCTGCAGAACCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19903
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028693 Nonsense 200 398 1 1
Genomic Location (Zv9):
Chromosome 2 (position 53782220)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 53335077
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGGGATTTGGATCGTGTCTGTGGTGGCCACCATCCCGCACGCCGTGTA[C/A]TCGACTACCGCGCAGGTGTCCGACGACGAGCTGTGCCTCGTGCGCTTTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link