EPHA2 (1 of 2)

Ensembl ID:
ENSDARG00000022727
Description:
EPH receptor A2 [Source:HGNC Symbol;Acc:3386]
Human Orthologue:
EPHA2
Human Description:
EPH receptor A2 [Source:HGNC Symbol;Acc:3386]
Mouse Orthologue:
Epha2
Mouse Description:
Eph receptor A2 Gene [Source:MGI Symbol;Acc:MGI:95278]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24328 Nonsense Mutation detected in F1 DNA During 2014
sa6734 Nonsense Mutation detected in F1 DNA During 2014
sa12632 Nonsense Available for shipment Available now
sa12623 Nonsense Available for shipment Available now
sa16254 Nonsense Available for shipment Available now
sa13554 Nonsense Available for shipment Available now
sa11198 Nonsense Available for shipment Available now
sa10796 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24328
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044918 Nonsense 36 979 2 17
Genomic Location:
Chromosome 23 (position 24681333)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCAAATTTTGCGTTATTGTCACAGAGGTGTTATTGGATATGGTGGCAT[C/A]GGGAGCTGAGTTGGGTTGGTTGACATCGCCTGTTAAGGATGGGGTGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6734
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044918 Nonsense 42 979 2 17
Genomic Location:
Chromosome 23 (position 24681314)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCACAGAGGTGTTATTGGATATGGTGGCATCGGGAGCTGAGTTGGGTTG[G/A]TTGACATCGCCTGTTAAGGATGGGGTGAGTTCACTTCTTATGTACGAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12632
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044918 Nonsense 66 979 3 17
ENSDART00000044918 Nonsense 66 979 3 17
Genomic Location:
Chromosome 23 (position 24680111)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTGGGAGATAGGCCAGCAGGCTGTGAATGGCTCTCTGTTGTATAACTA[T/A]TATGTATGTAACGTGGAKAAAGGAGAACAAGACAACTGGCTCCGTACTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12623
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044918 Nonsense 66 979 3 17
ENSDART00000044918 Nonsense 66 979 3 17
Genomic Location:
Chromosome 23 (position 24680111)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTGGGAGATAGGCCAGCAGGCTGTGAATGGCTCTCTGTTGTATAACTA[T/A]TATGTATGTAACGTGGAKAAAGGAGAACAAGACAACTGGCTCCGTACTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16254
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044918 Nonsense 67 979 3 17
Genomic Location:
Chromosome 23 (position 24680108)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGAGATAGGCCAGCAGGCTGTGAATGGCTCTCTGTTGTATAACTAWTA[T/A]GTATGTAACGTGGAKAAAGGAGAACAAGACAACTGGCTCCGTACTACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13554
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044918 Nonsense 234 979 3 17
ENSDART00000044918 Nonsense 234 979 3 17
Genomic Location:
Chromosome 23 (position 24679609)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTGCGGGAGGTGGCTGGAAGTTGTGTCAAAAATGCTATCAGTGAGGRC[C/T]AACCTCGCATTYATTGCACCACGGATGGGGAATGGGTCGTACCTATGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11198
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044918 Nonsense 234 979 3 17
ENSDART00000044918 Nonsense 234 979 3 17
Genomic Location:
Chromosome 23 (position 24679609)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTGCGGGAGGTGGCTGGAAGTTGTGTCAAAAATGCTATCAGTGAGGRC[C/T]AACCTCGCATTYATTGCACCACGGATGGGGAATGGGTCGTACCTATGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10796
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044918 Nonsense 671 979 11 17
Genomic Location:
Chromosome 23 (position 24650380)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACAGAGAAACAGAGGCAAGACTTCCTGAGTGAGGCCAGTATCATGGGA[C/T]AGTTCTCACACCAGAACATCATCCGGCTGGAAGGGGTTGTCACTAAATGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1fu33i2p