Q5RHN9_DANRE

Ensembl ID:
ENSDARG00000022718
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5RHN9]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32289 Nonsense Available for shipment Available now
sa37022 Nonsense Mutation detected in F1 DNA During 2017
sa23697 Nonsense Available for shipment Available now
sa11480 Nonsense Available for shipment Available now
sa11771 Nonsense Available for shipment Available now
sa29357 Nonsense Mutation detected in F1 DNA During 2017
sa43435 Nonsense Mutation detected in F1 DNA During 2017
sa11048 Nonsense Available for shipment Available now
sa32290 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32289
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062686 Nonsense 59 1995 3 9
ENSDART00000144195   None 937 None 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 23931471)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24050272
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTTAACACTATCCTTTCTCCACGGACCATGGAATCTATGGATATATA[T/A]GAGGAAATTATCAGAGAAGAACAAGAAGAAAAGGAAGCAACTTACAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37022
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062686 Nonsense 204 1995 6 9
ENSDART00000144195   None 937 None 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 23932240)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24051041
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTAAATCAGCAAACGGACAGGATCACTTCAACATCAATTTCAGCATCA[C/T]AGCCATTTGAGGTGCTCCAGAGATGTCCAAGAACTGAAAGTGAAAATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23697
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062686 Nonsense 408 1995 6 9
ENSDART00000144195   None 937 None 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 23932852)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24051653
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAGAAAGCAGCAGACACGGAGGTGCAGAGTCAAGGGCACATGCATAAA[C/T]AAAACGCAGAAAGAACAAGCAGAGAAACGAGACAATCTGGATTGAGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11480
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062686 Nonsense 884 1995 6 9
ENSDART00000144195   None 937 None 4
Genomic Location (Zv9):
Chromosome 20 (position 23934282)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24053083
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGAAGATGCAATTTCAGATAATGTTCCTCAGTCAATAGTTGATGGTTG[T/A]CTGCAACCARATCTTTTTGCCACCGTGTCTAAAGAGACTTCTCAGAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11771
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062686 Nonsense 917 1995 6 9
ENSDART00000144195   None 937 None 4
Genomic Location (Zv9):
Chromosome 20 (position 23934380)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24053181
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGARTTTCAAGGAAACACCCTGCCAATGTCTAAAGATGTTCTACTAGAAT[C/A]AAATGAGATTTGTCAGGGTGCTGTGTCATCCTCTGACAAGGAGCACAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29357
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062686 Nonsense 972 1995 6 9
ENSDART00000144195   None 937 None 4
Genomic Location (Zv9):
Chromosome 20 (position 23934544)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24053345
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATTTGTGCAGATCTTAATGGCCCAAGCAAAGTAATTTGTGATTTTGAA[C/T]AAGTTGATTCTGCAGAAGACGATAGAGAAAGGGAAATATTTGAAAATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43435
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062686 Nonsense 1804 1995 7 9
ENSDART00000144195 Nonsense 746 937 2 4
Genomic Location (Zv9):
Chromosome 20 (position 23937182)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24055983
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGGTAAACAAGCCCTGTCACATTTCAGAAACGGTAGAATCTCAACCAT[C/A]AAGCCAAAAGTCTTCATCTGAAGGTGATAAAACATTCTGCAACAATGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11048
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062686 Nonsense 1853 1995 7 9
ENSDART00000144195 Nonsense 795 937 2 4
ENSDART00000062686 Nonsense 1853 1995 7 9
ENSDART00000144195 Nonsense 795 937 2 4
Genomic Location (Zv9):
Chromosome 20 (position 23937329)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24056130
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAAACAGTGCAACAGARGTTAAAACATCAGAGAAGGYGTCAGAAAGTT[T/G]AAGCAASAACATTCAGAGCTTAAGTGCACCAGAAACGGAACCCRAGAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32290
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062686 Nonsense 1853 1995 7 9
ENSDART00000144195 Nonsense 795 937 2 4
ENSDART00000062686 Nonsense 1853 1995 7 9
ENSDART00000144195 Nonsense 795 937 2 4
Genomic Location (Zv9):
Chromosome 20 (position 23937329)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24056130
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAAACAGTGCAACAGAGGTTAAAACATCAGAGAAGGTGTCAGAAAGTT[T/A]AAGCAACAACATTCAGAGCTTAAGTGCACCAGAAACGGAACCCGAGAGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link