chic2

Ensembl ID:
ENSDARG00000022690
ZFIN ID:
ZDB-GENE-040426-778
Description:
cysteine-rich hydrophobic domain 2 protein [Source:RefSeq peptide;Acc:NP_957414]
Human Orthologue:
CHIC2
Human Description:
cysteine-rich hydrophobic domain 2 [Source:HGNC Symbol;Acc:1935]
Mouse Orthologue:
Chic2
Mouse Description:
cysteine-rich hydrophobic domain 2 Gene [Source:MGI Symbol;Acc:MGI:1921527]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3360 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3360
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030083 Essential Splice Site 44 169 1 6
Genomic Location:
Chromosome 1 (position 13291122)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTACGCTCCGGACCCGGTGGTAGTGCGCGGATCCGGACACGTCACTGT[G/T]TAAGAGACACCCGRCAGACCCACATCTCTTCACATAAAGCTTAATMATGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Blood pressure: Genome-wide association study identifies six new loci influencing pulse pressure and mean arterial pressure. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6fw593ov