add1

Ensembl ID:
ENSDARG00000022682
ZFIN ID:
ZDB-GENE-030909-2
Description:
alpha-adducin [Source:RefSeq peptide;Acc:NP_001073427]
Human Orthologue:
ADD1
Human Description:
adducin 1 (alpha) [Source:HGNC Symbol;Acc:243]
Mouse Orthologue:
Add1
Mouse Description:
adducin 1 (alpha) Gene [Source:MGI Symbol;Acc:MGI:87918]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9196 Nonsense Mutation detected in F1 DNA During 2014
sa9003 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9196
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030085 Nonsense 439 608 10 16
ENSDART00000102731 Nonsense 446 741 10 15
ENSDART00000127480 Nonsense 446 783 9 15
ENSDART00000134863 Nonsense 439 608 9 13
Genomic Location:
Chromosome 21 (position 2873019)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCCGTTAAAGCACAGTTTTCAGCGGCAGCAGCGGGACAAGACCCGCTG[G/A]CTGGCTGCAGGACGGCCCGACGAATCGGCWGAGGATGGGCAGGATGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9003
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030085 None None 608 None 16
ENSDART00000102731 None None 741 None 15
ENSDART00000127480 Essential Splice Site 660 783 13 15
ENSDART00000134863 None None 608 None 13
Genomic Location:
Chromosome 21 (position 2897726)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTCACTCRGCGGTGCTCAAAGCTCTGGGCTGTGAGACTGAAGCTGCAG[G/A]TATCGCCTGCGGAGGACACAYTTTTGCTGCTTTTCCWCTGTGTGGTACGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2865x7r8