add1

Ensembl ID:
ENSDARG00000022682
ZFIN ID:
ZDB-GENE-030909-2
Description:
alpha-adducin [Source:RefSeq peptide;Acc:NP_001073427]
Human Orthologue:
ADD1
Human Description:
adducin 1 (alpha) [Source:HGNC Symbol;Acc:243]
Mouse Orthologue:
Add1
Mouse Description:
adducin 1 (alpha) Gene [Source:MGI Symbol;Acc:MGI:87918]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37206 Essential Splice Site Mutation detected in F1 DNA During 2016
sa9196 Nonsense Mutation detected in F1 DNA During 2016
sa9003 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa37206
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030085 Essential Splice Site 380 608 None 16
ENSDART00000102731 Essential Splice Site 387 741 None 15
ENSDART00000127480 Essential Splice Site 387 783 None 15
ENSDART00000134863 Essential Splice Site 380 608 None 13
Genomic Location (Zv9):
Chromosome 21 (position 2872838)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 1999897
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGTTGTTGTTGTTTTTTTTGTTTTTTTTATCAACCTGTTTCTCTCTGC[A/G]GGGCTACAGGACTGGCTATCCGTATCGTTGCCCGGCGCTGCGTGATAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9196
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030085 Nonsense 439 608 10 16
ENSDART00000102731 Nonsense 446 741 10 15
ENSDART00000127480 Nonsense 446 783 9 15
ENSDART00000134863 Nonsense 439 608 9 13
Genomic Location (Zv9):
Chromosome 21 (position 2873019)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 1999716
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCCGTTAAAGCACAGTTTTCAGCGGCAGCAGCGGGACAAGACCCGCTG[G/A]CTGGCTGCAGGACGGCCCGACGAATCGGCWGAGGATGGGCAGGATGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9003
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030085   None 608 None 16
ENSDART00000102731   None 741 None 15
ENSDART00000127480 Essential Splice Site 660 783 13 15
ENSDART00000134863   None 608 None 13
Genomic Location (Zv9):
Chromosome 21 (position 2897726)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 1975109
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTCACTCRGCGGTGCTCAAAGCTCTGGGCTGTGAGACTGAAGCTGCAG[G/A]TATCGCCTGCGGAGGACACAYTTTTGCTGCTTTTCCWCTGTGTGGTACGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link