armc2

Ensembl ID:
ENSDARG00000022660
ZFIN ID:
ZDB-GENE-041014-7
Description:
Novel armadillo repeat containg protein [Source:UniProtKB/TrEMBL;Acc:Q5RGN1]
Human Orthologue:
ARMC2
Human Description:
armadillo repeat containing 2 [Source:HGNC Symbol;Acc:23045]
Mouse Orthologue:
Armc2
Mouse Description:
armadillo repeat containing 2 Gene [Source:MGI Symbol;Acc:MGI:1916449]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23743 Nonsense Mutation detected in F1 DNA During 2014
sa23742 Nonsense Mutation detected in F1 DNA During 2014
sa16315 Nonsense Available for shipment Available now
sa13172 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23743
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062987 Nonsense 420 812 9 17
ENSDART00000101811 None None 582 None 13
ENSDART00000148256 None None 192 None 4
Genomic Location:
Chromosome 20 (position 32291173)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGGTCAGATGGAGAAGGCCAGCAGATCATCACAGGACACATACTGGTA[C/T]AGGTAAGAGATCCTTGACAGCTGCCTGAGTTGTGAAAGAGACAAAGTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23742
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062987 Nonsense 582 812 12 17
ENSDART00000101811 Nonsense 352 582 8 13
ENSDART00000148256 None None 192 None 4
Genomic Location:
Chromosome 20 (position 32282271)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCAGACTGCTGGCCAACCTGGCCATCCATCCCACAGTGGGCACAGCAT[T/A]GGCTGCCAACACATTGTGTGTACAGCTGCTACTGGAGGTTCTGGGTACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16315
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062987 Nonsense 702 812 15 17
ENSDART00000101811 Nonsense 472 582 11 13
ENSDART00000148256 None None 192 None 4
Genomic Location:
Chromosome 20 (position 32275626)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCAAGAGCCCTGATGTGTGTTTCTCTKCATGTGGAGTTCTCATCAACT[T/G]ATCTGCAGATCCCGACAACAGGGCCATGCTGAGCGCMGAGGGAGCCGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13172
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062987 Nonsense 733 812 16 17
ENSDART00000101811 Nonsense 503 582 12 13
ENSDART00000148256 None None 192 None 4
Genomic Location:
Chromosome 20 (position 32275456)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTCTCCAGGCTTGTTGACTGTCTGCGTGACTTCGGGCCTCARGACTG[G/A]CATTTAGCCGCTGTGGTGTGTCAGACTCTGTGGAACTGCTCTTTAGATGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/au0pvp8o