psmf1

Ensembl ID:
ENSDARG00000022652
ZFIN ID:
ZDB-GENE-040718-282
Description:
Zgc:92785 [Source:UniProtKB/TrEMBL;Acc:Q6DGT0]
Human Orthologue:
PSMF1
Human Description:
proteasome (prosome, macropain) inhibitor subunit 1 (PI31) [Source:HGNC Symbol;Acc:9571]
Mouse Orthologue:
Psmf1
Mouse Description:
proteasome (prosome, macropain) inhibitor subunit 1 Gene [Source:MGI Symbol;Acc:MGI:1346072]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15640 Nonsense Available for shipment Available now
sa13126 Essential Splice Site, Splice Site Available for shipment Available now
sa20820 Essential Splice Site, Missense Available for shipment Available now

Mutation Details

Allele Name:
sa15640
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031597 Nonsense 37 136 1 8
ENSDART00000123304 Nonsense 37 242 1 7
Genomic Location (Zv9):
Chromosome 6 (position 51761551)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 51810733
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTGATTTGTTTTGTACACTGGGAAATAGTGAAAAGTGGCTAKAAATG[T/A]ATRGGCATTGGAGATGAGGTAAGTGAACGTTGATTTTAATCGTATAAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13126
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031597 Essential Splice Site 78 136 3 8
ENSDART00000123304 Splice Site None 242 None 7
Genomic Location (Zv9):
Chromosome 6 (position 51759647)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 51808829
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTTTGCAGGATTCCACRACAGAAAAAGTGACTGATCTCACAGTGAA[C/T]CTGAGYGARTATGTTGAMGAGGCCAATCTGCACACATTTGAAAGGTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20820
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031597 Missense 78 136 3 8
ENSDART00000123304 Essential Splice Site 78 242 3 7
Genomic Location (Zv9):
Chromosome 6 (position 51759645)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 51808827
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTGCAGGATTCCACGACAGAAAAAGTGACTGATCTCACAGTGAACC[T/G]GAGCGAGTATGTTGACGAGGCCAATCTGCACACATTTGAAAGGTTTGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link