cyp2j22

Ensembl ID:
ENSDARG00000022631
ZFIN ID:
ZDB-GENE-040120-2
Description:
cytochrome P450, family 2, subfamily J, polypeptide 22 [Source:RefSeq peptide;Acc:NP_956914]
Human Orthologue:
CYP2J2
Human Description:
cytochrome P450, family 2, subfamily J, polypeptide 2 [Source:HGNC Symbol;Acc:2634]
Mouse Orthologues:
Cyp2j11-ps, Cyp2j5, Cyp2j6, Cyp2j9
Mouse Descriptions:
cytochrome P450, family 2, subfamily j, polypeptide 11, pseudogene Pseudogene [Source:MGI Symbol;Acc
cytochrome P450, family 2, subfamily j, polypeptide 5 Gene [Source:MGI Symbol;Acc:MGI:1270149]
cytochrome P450, family 2, subfamily j, polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:1270148]
cytochrome P450, family 2, subfamily j, polypeptide 9 Gene [Source:MGI Symbol;Acc:MGI:1921769]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23708 Nonsense Mutation detected in F1 DNA During 2014
sa19234 Nonsense Mutation detected in F1 DNA During 2014
sa9356 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23708
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030229 Nonsense 23 496 1 9
ENSDART00000063128 Nonsense 23 497 1 9
Genomic Location:
Chromosome 20 (position 25611369)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACGAGTGGATCGATATCAAAAGTATTTTGATATTTCTGTGTGTGTTTT[T/A]ATTGCTGGGTGATTATATAAAAAATAAAGCGCCCAAGAACTTTCCTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19234
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030229 Nonsense 126 496 3 9
ENSDART00000063128 Nonsense 127 497 3 9
ENSDART00000030229 Nonsense 126 496 3 9
ENSDART00000063128 Nonsense 127 497 3 9
Genomic Location:
Chromosome 20 (position 25611937)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACTGTGAAGGTCTGCTTCATAAACAGGTATAGTTCTGTCCAGCGGATA[T/G]AAATGGAAGCATCAGAGGAGATTTGCACTCTCGACTCTTCGAAATTTCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9356
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030229 Nonsense 126 496 3 9
ENSDART00000063128 Nonsense 127 497 3 9
ENSDART00000030229 Nonsense 126 496 3 9
ENSDART00000063128 Nonsense 127 497 3 9
Genomic Location:
Chromosome 20 (position 25611937)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACTGTGAAGGTCTGCTTCATAAACAGGTATAGTTCTGTCCAGCGGATA[T/G]AAATGGAAGCATCAGAGGAGATTTGCACTYTCGACTCTTCGAAATTTCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/e45hb3pb