si:ch211-241e1.3

Ensembl ID:
ENSDARG00000022615
ZFIN ID:
ZDB-GENE-030131-230
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A8DZG5]
Human Orthologue:
LAMA3
Human Description:
laminin, alpha 3 [Source:HGNC Symbol;Acc:6483]
Mouse Orthologue:
Lama3
Mouse Description:
laminin, alpha 3 Gene [Source:MGI Symbol;Acc:MGI:99909]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19647 Essential Splice Site Available for shipment Available now
sa32820 Nonsense Mutation detected in F1 DNA During 2017
sa13307 Nonsense Available for shipment Available now
sa1076 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa19647
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058281 Essential Splice Site 644 1368 15 31
ENSDART00000140540 Essential Splice Site 623 1347 15 31

The following transcripts of ENSDARG00000022615 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 1149327)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1095148
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTTAAGTGCTTACACATTTGTATTTCTTTTTTTGTTCTGTTGTTTCA[G/A]GATGTCAGTCAAGGGGATTTAATCAACAGAGCACAAGATCTGAAAACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32820
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058281 Nonsense 1016 1368 22 31
ENSDART00000140540 Nonsense 995 1347 22 31

The following transcripts of ENSDARG00000022615 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 1138744)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1084565
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGGCTGCATTGAGTTTTCCACCTTCAATGAAAAATTCCTCAGTCTGTA[C/A]AACTTTAAGAACGCCGTCAATATTAACCTGGAAACTCCTTGTAAGAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13307
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058281 Nonsense 1156 1368 25 31
ENSDART00000140540 Nonsense 1135 1347 25 31

The following transcripts of ENSDARG00000022615 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 1136536)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1082357
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGACCACCGAAGTCAAAAGGGACGTCAATATTCCAAGGAAATTCCTTTA[T/G]TACTACATCGGTGGAATTCCCAGCATTTTGCGTGAGAGRTTTGTATCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1076
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058281 Essential Splice Site 1169 1368 25 31
ENSDART00000140540 Essential Splice Site 1148 1347 25 31

The following transcripts of ENSDARG00000022615 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 1136497)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1082318
KASP Assay ID:
554-0978.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATTCCTTTATTACTACATCGGTGGAATTCCCAGCATTTTGCGTGAGAG[G/A]TTTGTATCTTGGTGGCTTCCCTTTAGGATGTATATATTTTCTAAACACTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link