dnpep

Ensembl ID:
ENSDARG00000022599
ZFIN ID:
ZDB-GENE-040426-852
Description:
aspartyl aminopeptidase [Source:RefSeq peptide;Acc:NP_956447]
Human Orthologue:
DNPEP
Human Description:
aspartyl aminopeptidase [Source:HGNC Symbol;Acc:2981]
Mouse Orthologue:
Dnpep
Mouse Description:
aspartyl aminopeptidase Gene [Source:MGI Symbol;Acc:MGI:1278328]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1144 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1144
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009382 Nonsense 230 469 8 15
ENSDART00000122487 Nonsense 235 474 8 15
ENSDART00000135974 Nonsense 235 302 8 10
ENSDART00000136006   None 179 None 6
Genomic Location (Zv9):
Chromosome 6 (position 13818420)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 13778382
KASP Assay ID:
554-1055.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCRCTCATCCAGATGTTATGTGGACTGCTTTCAGTGGAGYCGAATGATT[T/A]ACTGGACTTTGAGCTCTGTCTGGTGGACACACAGCCTGGCGTAAGTCTCG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link