LOC566750

Ensembl ID:
ENSDARG00000022570
Human Orthologue:
NMUR2
Human Description:
neuromedin U receptor 2 [Source:HGNC Symbol;Acc:16454]
Mouse Orthologue:
Nmur2
Mouse Description:
neuromedin U receptor 2 Gene [Source:MGI Symbol;Acc:MGI:2441765]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13171 Nonsense Available for shipment Available now
sa21931 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13171
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028641 Nonsense 35 342 1 2
Genomic Location:
Chromosome 11 (position 28986493)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTACCTTCAGACCATTGATGAAGTTCWGTTTAAGCTTCTGGGCCCAAGA[C/T]RATCTCCKTTYTTCTTCCCTGTAACCTGTACTTACWTCCTCATCTTCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21931
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028641 Nonsense 158 342 1 2
Genomic Location:
Chromosome 11 (position 28986862)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGATTCACCCGCTCAAAACCCGTTACGCCATCACCAACAAGCACGCT[C/T]GAAGGGTCATCGCTGGGGTTTGGGCTATGTCTCTGCTCTGCGCCGTCCCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Optic disc size (rim): Genome-wide association identifies ATOH7 as a major gene determining human optic disc size. (View Study)
  • Schizophrenia: Genome-wide association study in a Swedish population yields support for greater CNV and MHC involvement in schizophrenia compared with bipolar disorder. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/koj2gk8k