nkx6.1

Ensembl ID:
ENSDARG00000022569
ZFIN ID:
ZDB-GENE-040718-178
Description:
homeobox protein Nkx-6.1 [Source:RefSeq peptide;Acc:NP_001002475]
Human Orthologue:
NKX6-1
Human Description:
NK6 homeobox 1 [Source:HGNC Symbol;Acc:7839]
Mouse Orthologue:
Nkx6-1
Mouse Description:
NK6 homeobox 1 Gene [Source:MGI Symbol;Acc:MGI:1206039]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3108 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa3108
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029874 Essential Splice Site 231 312 2 3
ENSDART00000123309 Essential Splice Site 231 311 2 5
Genomic Location (Zv9):
Chromosome 21 (position 17887185)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19035437
KASP Assay ID:
554-2486.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGAGCCCGACTAGCCTACTCTTTAGGAATGACAGAGAGTCAAGTCAAG[G/A]TAAGACACCCAATAGTTTATGACGAAGGAACGAGGAAAWCTATCTATCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link