
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
gxylt1
- Ensembl ID:
- ENSDARG00000022550
- ZFIN ID:
- ZDB-GENE-041210-116
- Description:
- Glucoside xylosyltransferase 1 [Source:UniProtKB/Swiss-Prot;Acc:Q5SP46]
- Human Orthologue:
- GXYLT1
- Human Description:
- glucoside xylosyltransferase 1 [Source:HGNC Symbol;Acc:27482]
- Mouse Orthologue:
- Gxylt1
- Mouse Description:
- glucoside xylosyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:2684933]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa31388 | Essential Splice Site | Available for shipment | Available now |
sa15769 | Essential Splice Site | Available for shipment | Available now |
sa20239 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa31388
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000032805 | Essential Splice Site | 125 | 405 | 2 | 7 |
- Genomic Location (Zv9):
- Chromosome 4 (position 12964344)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 13900971 GRCz11 4 13899820 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GATTTCACATCTTTGCAGAGCAACAGTTACAAACCAGCATTAAAGCAGAT[G/A]TTAGTAGGAGCCACTGTCAATTCTGACATGCATACATTTACATTATCAGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15769
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000032805 | Essential Splice Site | 126 | 405 | 3 | 7 |
- Genomic Location (Zv9):
- Chromosome 4 (position 12963196)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 13899823 GRCz11 4 13898672 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TAAGGAGATGAAAGATTTACCCTTTGCCAATCCATTTTTNCCTCTTGTACA[G/T]CTGGATTCCTGGCCGGCTTTCATCCAAGGGAAATTCAGCTATGTTCTTCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20239
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000032805 | Essential Splice Site | 169 | 405 | 3 | 7 |
- Genomic Location (Zv9):
- Chromosome 4 (position 12963062)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 13899689 GRCz11 4 13898538 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGGAGTCAGCTTTTCAAACCGTGTGCTTCACAGAGACTCTTCCTGCCCG[T/C]GAGTATTTCTGCAACTATTTAAGGAGACACACTGCAGGTAAAAACACTGG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: