gxylt1

Ensembl ID:
ENSDARG00000022550
ZFIN ID:
ZDB-GENE-041210-116
Description:
Glucoside xylosyltransferase 1 [Source:UniProtKB/Swiss-Prot;Acc:Q5SP46]
Human Orthologue:
GXYLT1
Human Description:
glucoside xylosyltransferase 1 [Source:HGNC Symbol;Acc:27482]
Mouse Orthologue:
Gxylt1
Mouse Description:
glucoside xylosyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:2684933]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31388 Essential Splice Site Available for shipment Available now
sa15769 Essential Splice Site Available for shipment Available now
sa20239 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31388
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032805 Essential Splice Site 125 405 2 7
Genomic Location (Zv9):
Chromosome 4 (position 12964344)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13900971
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTTCACATCTTTGCAGAGCAACAGTTACAAACCAGCATTAAAGCAGAT[G/A]TTAGTAGGAGCCACTGTCAATTCTGACATGCATACATTTACATTATCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15769
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032805 Essential Splice Site 126 405 3 7
Genomic Location (Zv9):
Chromosome 4 (position 12963196)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13899823
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAGGAGATGAAAGATTTACCCTTTGCCAATCCATTTTTNCCTCTTGTACA[G/T]CTGGATTCCTGGCCGGCTTTCATCCAAGGGAAATTCAGCTATGTTCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20239
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032805 Essential Splice Site 169 405 3 7
Genomic Location (Zv9):
Chromosome 4 (position 12963062)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13899689
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGAGTCAGCTTTTCAAACCGTGTGCTTCACAGAGACTCTTCCTGCCCG[T/C]GAGTATTTCTGCAACTATTTAAGGAGACACACTGCAGGTAAAAACACTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link