gxylt1

Ensembl ID:
ENSDARG00000022550
ZFIN ID:
ZDB-GENE-041210-116
Description:
Glucoside xylosyltransferase 1 [Source:UniProtKB/Swiss-Prot;Acc:Q5SP46]
Human Orthologue:
GXYLT1
Human Description:
glucoside xylosyltransferase 1 [Source:HGNC Symbol;Acc:27482]
Mouse Orthologue:
Gxylt1
Mouse Description:
glucoside xylosyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:2684933]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15769 Essential Splice Site Available for shipment Available now
sa20239 Essential Splice Site Mutation detected in F1 DNA During 2014
sa2178 Nonsense Mutation detected in F1 DNA During 2014
sa5253 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15769
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032805 Essential Splice Site 126 405 3 7
Genomic Location:
Chromosome 4 (position 12963196)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAGGAGATGAAAGATTTACCCTTTGCCAATCCATTTTTNCCTCTTGTACA[G/T]CTGGATTCCTGGCCGGCTTTCATCCAAGGGAAATTCAGCTATGTTCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20239
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032805 Essential Splice Site 169 405 3 7
Genomic Location:
Chromosome 4 (position 12963062)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGAGTCAGCTTTTCAAACCGTGTGCTTCACAGAGACTCTTCCTGCCCG[T/C]GAGTATTTCTGCAACTATTTAAGGAGACACACTGCAGGTAAAAACACTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2178
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032805 Nonsense 351 405 6 7
Genomic Location:
Chromosome 4 (position 12960347)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTCACAGYGACAAACAGCCTGCCTTCAGAGCCGTGTATGAGGCTTTC[G/T]AACAGGTGATTAGTTTATTCAGAGGAGTACTGTTARTAGCTWTTAGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5253
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032805 Nonsense 398 405 7 7
Genomic Location:
Chromosome 4 (position 12957818)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGYGAGTCATTTCTTCACCACGGGACTCCAAAAGTCTGTCAGKAGGCTC[C/T]AGAGAGCGACTCCACCAGGTGACTGAGACGTGATTCTGTCATGGTAGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ch1bgxkm