ntn1b

Ensembl ID:
ENSDARG00000022531
ZFIN ID:
ZDB-GENE-990415-168
Description:
netrin 1b [Source:RefSeq peptide;Acc:NP_571073]
Human Orthologue:
NTN1
Human Description:
netrin 1 [Source:HGNC Symbol;Acc:8029]
Mouse Orthologue:
Ntn1
Mouse Description:
netrin 1 Gene [Source:MGI Symbol;Acc:MGI:105088]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2087 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa2087
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039482 Nonsense 529 602 6 6
Genomic Location (Zv9):
Chromosome 3 (position 25813126)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25581311
KASP Assay ID:
554-2490.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACCATCAACATCATATCGGTGTATAAGCAGGGTGGACACCGCATCCGC[A/T]GAGGAGACCAGCTCCTGTGGGTCAGGGCAAAAGACGTTGCCTGCAAGTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link