mchr1b

Ensembl ID:
ENSDARG00000022525
ZFIN ID:
ZDB-GENE-030502-5
Description:
Melanin-concentrating hormone receptor 1b [Source:UniProtKB/TrEMBL;Acc:Q801F5]
Human Orthologue:
MCHR1
Human Description:
melanin-concentrating hormone receptor 1 [Source:HGNC Symbol;Acc:4479]
Mouse Orthologue:
Mchr1
Mouse Description:
melanin-concentrating hormone receptor 1 Gene [Source:MGI Symbol;Acc:MGI:2180756]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1871 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1871
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039448 Nonsense 126 326 1 1
Genomic Location:
Chromosome 3 (position 25609897)
KASP Assay ID:
554-1862.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCACATTCGCACTCCCCGTGTAGCCGTGGCAGTAGTAGCGCTGGTGTG[G/A]ATCCTCTCACTGCTCTCCATCACCCCAGTGTGGATGTATGCGGGTCTCAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bxnb9rll