si:dkey-149g8.1

Ensembl ID:
ENSDARG00000022518
ZFIN ID:
ZDB-GENE-070705-298
Description:
Novel protein similar to H.sapiens peroxisomal biogenesis factor 5 [Source:UniProtKB/TrEMBL;Acc:A5PF
Human Orthologue:
PEX5L
Human Description:
peroxisomal biogenesis factor 5-like [Source:HGNC Symbol;Acc:30024]
Mouse Orthologue:
Pex5l
Mouse Description:
peroxisomal biogenesis factor 5-like Gene [Source:MGI Symbol;Acc:MGI:1916672]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12117 Nonsense Available for shipment Available now
sa20717 Nonsense Available for shipment Available now
sa9691 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12117
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104293 Nonsense 223 602 7 14
ENSDART00000139234   None 144 None 4
ENSDART00000143504 Nonsense 7 386 1 8
Genomic Location (Zv9):
Chromosome 6 (position 29227451)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 29523094
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAYTGCTACTCTGTTTGCRTGTGTTTGACAGGGCCGATTGAGCAAAGAG[C/T]AGAGGTGGGGCAGCACACTGCTGTCCAGAAACCAGTCTCTGGAGGAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20717
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104293 Nonsense 311 602 9 14
ENSDART00000139234   None 144 None 4
ENSDART00000143504 Nonsense 95 386 3 8
Genomic Location (Zv9):
Chromosome 6 (position 29211735)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 29507378
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACCCTTTCAAAGACTGGCCAAATGCTTTTGAGGAGGGATTGCGCAAGT[C/A]GAGAGAAGGAGAGCTGCCGAACGCTGTGCTTCTTCTGGAAGCTGCCGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9691
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104293 Nonsense 589 602 14 14
ENSDART00000139234   None 144 None 4
ENSDART00000143504 Nonsense 373 386 8 8
Genomic Location (Zv9):
Chromosome 6 (position 29191652)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 29487295
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TYGCTCTCTCCATGCTGGACCAGCCGGAGCTCTTTCAAGCTGCTAACATC[G/T]GAGACCTGGATTTACTAATGAAAGCTTTCAAYCTGGACATGTGAGAGAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 2 diabetes: Transferability of type 2 diabetes implicated loci in multi-ethnic cohorts from Southeast Asia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link