cox4i2

Ensembl ID:
ENSDARG00000022509
ZFIN ID:
ZDB-GENE-040426-1775
Description:
cytochrome c oxidase subunit IV isoform 2 [Source:RefSeq peptide;Acc:NP_957097]
Human Orthologue:
COX4I2
Human Description:
cytochrome c oxidase subunit IV isoform 2 (lung) [Source:HGNC Symbol;Acc:16232]
Mouse Orthologue:
Cox4i2
Mouse Description:
cytochrome c oxidase subunit IV isoform 2 Gene [Source:MGI Symbol;Acc:MGI:2135755]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37666 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37666
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104487 Nonsense 176 177 5 5
Genomic Location (Zv9):
Chromosome 23 (position 19239445)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19024552
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCCTGTGCAGGGCTTCGCAGCCAAGTGGGACTATGAAAAGGGCCAGTG[G/A]AAATAAAGGGAATGCAGCGTCACATCCACACCTTGCCAATTACTACATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link