pkd2l1

Ensembl ID:
ENSDARG00000022503
ZFIN ID:
ZDB-GENE-030616-558
Description:
Novel protein similar to human polycystic kidney disease 2-like 1 (PKD2L1) [Source:UniProtKB/TrEMBL;
Human Orthologue:
PKD2L1
Human Description:
polycystic kidney disease 2-like 1 [Source:HGNC Symbol;Acc:9011]
Mouse Orthologue:
Pkd2l1
Mouse Description:
polycystic kidney disease 2-like 1 Gene [Source:MGI Symbol;Acc:MGI:1352448]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22300 Essential Splice Site Available for shipment Available now
sa42207 Nonsense Mutation detected in F1 DNA During 2017
sa6303 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa22300
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002415 Essential Splice Site 166 805 3 15
ENSDART00000145948 Essential Splice Site 151 790 3 15
Genomic Location (Zv9):
Chromosome 13 (position 25681546)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25327206
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACGGCATGAGCTTCTCCTCCATTGGCTGCATGAATGATGTCTGGACGG[T/C]GAGCTTGAGCTGCTTTTCTTGTTCCCTGGTAAAAAGAAAAGGCAAAGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42207
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002415 Nonsense 341 805 6 15
ENSDART00000145948 Nonsense 326 790 6 15
Genomic Location (Zv9):
Chromosome 13 (position 25687072)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25332732
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAGATTAGTGGTTGAGTTTCCAGCTACCGGTGGAGCGATTCCATCCTA[T/A]CAGATCCGCACTGTGAAGCTGATTCGTTATGTCACCACCTGGGACTACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6303
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002415 Essential Splice Site 673 805 12 15
ENSDART00000145948 Essential Splice Site 658 790 12 15
Genomic Location (Zv9):
Chromosome 13 (position 25692251)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25337911
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACAAGCAGGAGCAGGAGAACAWGAAGCAGGAGCTGGAGGAGAAAAGGG[T/A]AWGTTTGTTTAATTTAGCTAGTTAGWRTTGATGGATGACACTGATTTWGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • Sphingolipid levels: Genome-wide association study identifies novel loci associated with circulating phospho- and sphingolipid concentrations. (View Study)
  • Stearic acid (18:0) plasma levels: Genome-wide association study identifies novel loci associated with concentrations of four plasma phospholipid fatty acids in the de novo lipogenesis pathway: results from the Cohorts for Heart and Aging Research in Genomic Epidemiology (CHARGE) consortium. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link