eno1

Ensembl ID:
ENSDARG00000022456
ZFIN ID:
ZDB-GENE-030131-6048
Description:
alpha-enolase [Source:RefSeq peptide;Acc:NP_997887]
Human Orthologue:
ENO1
Human Description:
enolase 1, (alpha) [Source:HGNC Symbol;Acc:3350]
Mouse Orthologues:
Eno1, Gm5506
Mouse Descriptions:
enolase 1, alpha non-neuron Gene [Source:MGI Symbol;Acc:MGI:95393]
predicted gene 5506 Gene [Source:MGI Symbol;Acc:MGI:3648653]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24319 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24319
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009337 Essential Splice Site 289 432 8 12
ENSDART00000133322 Essential Splice Site 289 303 8 9

The following transcripts of ENSDARG00000022456 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 22965562)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGACAAGCTGGCTGACCTCTACAAGAGCTTTGTCAAGGATTATCCTGG[T/C]CAGTAGCCCTGATCTTCAGTGTTACTGTGTTTTCGTGTGTGATCCTTTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fnqp6kxl