faf1

Ensembl ID:
ENSDARG00000022418
ZFIN ID:
ZDB-GENE-040426-2863
Description:
FAS-associated factor 1 [Source:RefSeq peptide;Acc:NP_998138]
Human Orthologue:
FAF1
Human Description:
Fas (TNFRSF6) associated factor 1 [Source:HGNC Symbol;Acc:3578]
Mouse Orthologue:
Faf1
Mouse Description:
Fas-associated factor 1 Gene [Source:MGI Symbol;Acc:MGI:109419]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9643 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9643
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034004 Nonsense 475 675 14 19
ENSDART00000115419 Nonsense 475 683 14 22
Genomic Location:
Chromosome 8 (position 16833138)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YAGCGTTGTTGCACAGACCATTCGGACATACAAGACTGACCAGTTCCCAT[T/A]ACTTTTAATAGTCATGGGCAAACGGACATCAAATGAAGTTTTAAATGTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tvcvu58z